Reagents

β-HB (166898) was bought from Sigma Chemical Co (St. Louis, MO). Triglycerides (TG), total cholesterol (TC), alanine aminotransferase (ALT), aspartate aminotransferase (AST) and β-HB assay kits were from Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). The ELISA kit for insulin was obtained from Jianglai Corp (Shanghai, China). Flag-tag (20543-1-AP), β-actin (66009-1-Ig) and Caspase1 (22915-1-AP) antibodies for western bolting, and PES1 (13553-1-AP) antibody for immunofluorescence were obtained from Proteintech, Chicago, USA. PES-1 (NBP2-55211) antibody for western bolting and SREBP1c antibody (NB600-582) for immunofluorescence were bought from Novus Biologicals. SREBP1c (191857), SCD1 (ab19862) and SREBP2 (ab155017) antibodies for western bolting were purchased from Abcam. FASN (3180S) antibody for western bolting was from Cell Signaling Technology (Beverley, MA). NLRP3 (DF7438) and GSDMD (AF4012) antibodies for western bolting were from Affinity. CHOP (sc-7351), p300 (sc-48343) and Ac-SREBP1c (Acetylated-SREBP1c, sc-13551 AC) antibodies were bought from Santa Cruz Biotechnology. RNAex Pro Reagent (AG21102), reverse transcription kits (AG11707), SYBR Green qPCR SuperMix (AG11718) were bought from Accurate Biology. Cell counting kit-8 (CCK-8) (C0005) was from Target Mol (Shanghai, China). Chromatin immunoprecipitation (ChIP) assay kit (P2078) was purchased from Beyotime. Rat Pes1 and Caspase1 short interfering RNA (siRNA) and Pes1 overexpression plasmid were purchased from GENERAL BIOL (Anhui, China).

Animal grouping

Five-week-old male C57BL/6J and KKAy (KK.Cg-Ay/J) mice were from Beijing Vital River. The housing unit was maintained at constant temperature 22–25 °C and 50–60% relative humidity with a 12/12-h light/dark cycle and free access to tap water. KKAy mice were fed with commercial high-fat diet (BEIJING HFK Bio-Technology Co., Ltd., Beijing, China) ad libitum for 4 weeks to increase their plasma glucose levels. After 4 weeks, all mice were divided into four groups (10–12 mice per group), including C57BL/6J fed with standard diet (SD, LAD3001G, Trophic Animal Feed High-Tech Co., Ltd, China) (C57BL/6J-SD) and ketogenic diet (KD, TP 201455, Trophic Animal Feed High-Tech Co., Ltd, China) (C57BL/6J-KD), and KKAy fed with SD (KKAy-SD) and KD (KKAy-KD). The composition of the diet was listed in Additional file 1: Table S1. All mice were fed for 16 weeks. The food and water intakes were measured three times a week and taken by the average. Body weight and fasting plasma glucose (fasted for 6–8 h) were recorded once a week. Feeding efficiency was calculated as body weight gain (mg) per kcal food consumed. Our procedures on mice obeyed the guidelines for humane treatment set by the Association of Laboratory Animal Sciences at Anhui Medical University.

GTT and ITT tests

Fasting glucose was measured weekly by Roche blood glucose meter. Glucose tolerance test (GTT) and insulin tolerance test (ITT) were performed before the mice were sacrificed, the concentrations of glucose and insulin for intraperitoneal injection were 2 mg/g body weight and 0.7 mU/g body weight, respectively. Blood glucose samples were tested at 0, 30, 60, 90, 120, 150 min and 0, 20, 40, 60, 80, 100, 120 min, respectively. Area-under-curve (AUC) was calculated by the trapezoid rule.

Murine tissue and blood sample collection

By the end of experiment, all fasted mice were euthanized with 10% chloral hydrate and then killed by cervical dislocation to obtain tissues and blood samples. Blood was immediately centrifuged at 3000 rpm for 10 min and the levels of insulin in plasma were detected by enzyme linked immunosorbent assay (ELISA) kits. The homeostatic model assessment of insulin resistance (HOMA-IR) index was calculated using the following formula: fasting insulin levels (mIU/L) × fasting glucose levels (mmol/L)/22.5. The remaining plasma was stored at − 80 °C for later analysis. The liver tissues were rinsed with cold phosphate-buffered saline (PBS). Small portions of liver tissues were fixed in 4% paraformaldehyde solution for oil red O and hematoxylin–eosin (H&E) staining respectively. Then two-third of liver per mice was frozen in liquid nitrogen immediately and kept at − 80 °C for immunoblotting and biochemical analysis. The remaining livers were preserved in RNAlater for qRT-PCR test. TC, TG, ALT and AST were determined using enzymatic kits in accordance with the manufacturer’s instruction.

Cell culture

McArdle 7777 rat hepatoma cells were obtained from the American Type Culture Collection (Manassas, VA, USA, cat# CRL-1601). McArdle 7777 cells were cultured in DMEM with high glucose concentration (25 mmol/L), supplemented with 10% FBS and 1% penicillin/streptomycin in an incubation chamber with 5% CO2 at 37 ℃. The concentration and time of β-hydroxybutyric acid (β-HB) treatment were selected depending on cell counting kit-8 (CCK-8) test. Specifically, McArdle liver cells were seeded in the 96-well plates for 24 h. Then by the β-HB treatment with a series of concentrations (0, 0.25, 1, 2, 4 mM) and times (0, 12, 24, 48 h), CCK-8 reagents (10 µL) were added into the treated cells. Next, the cells were incubated for 1–4 h at 37 °C. Simultaneously, the medium was treated in the same way. The absorbance at 450 nm was detected by the microplate reader. Cellular viability was calculated by the absorbance values, by which the most suitable treatment concentration and time of β-HB were determined.

Quantitative real-time PCR

The total RNAs were extracted using RNAex Pro reagent. The genomic DNA was removed using RNase-free DNase. Purified total RNA (1 μg) was reverse-transcribed using reverse transcriptase. qRT-PCR was performed with a Roche Light Cycler 480 System with SYBR Green Super Mix using gene-specific primers (Additional file 1: Table S2). The comparative Ct method was used to determine the amount of target normalized to an endogenous reference (β-Actin) and relative to a calibrator (2Ct).

Immunoblotting

McArdle 7777 cells and liver tissues (30 mg/per sample) were homogenized in lysis buffer, respectively. Total lysates (20 μg per well) were separated electrophoretically by 10% SDS-PAGE and transferred onto PVDF membranes. The membranes were respectively incubated for 24 h with CHOP, PES1, p300, SREBP1c, SREBP2, FASN, SCD1, NLRP3, Caspase 1, GSDMD antibodies at 4 °C. β-Actin was used as a loading control. After being washed 8 min for 4 times with TBST buffer, the membranes were incubated with secondary antibodies for 60 min. The enhanced chemiluminescence reagent was used. The signal was then detected by the digital imaging equipment.

Immunofluorescence

McArdle 7777 cells were seeded onto 12-well plate containing cell climbing slides for 24 h. After β-HB treatments, cells were washed thrice with PBS and fixed with 4% paraformaldehyde for 20 min. Nonspecific binding sites were blocked with 5% normal bovine serum in PBS. The 12-well plates were incubated with the mixture of primary antibodies including PES1 (1:250) and SREBP1c (1:250) at 4 °C overnight. After PBS washing, the 12-well plates were incubated for 60 min with the Alexa Fluor 488 conjugated secondary antibody (ab150077, Abcam) or Alexa Fluor 568 conjugated secondary antibody (ab175473, Abcam). Cell climbing slides were taken out from the 12-well plate and buckled upside down on the glass slide containing DAPI. All sections were mounted and observed by a confocal microscope (LSM880, Zeiss).

RNA interference of Pes1 and Caspase1

Rat Pes1 and Caspase1 small interfering RNA (siRNA) and Lipofectamine 3000 (L3000008, Invitrogen Life Technologies Crop) were mixed in serum-free medium for 20 min, respectively. Then the mixture was added to the culture medium to transfect McArdle 7777 cells. After 6 h, the cells continue to be cultured in fresh medium for 48 h. Finally, cells were collected for subsequent measuring TG, TC, and running Western Blotting and qRT-PCR. The sequences of Pes1 siRNA were 5ʹ-UGAAGAAGCGAGAGAAGUATTT-3ʹ (forward) and 5ʹ-UACUUCUCUCGC UUCUUCATT-3ʹ (reverse). The sequences of Caspase1 siRNA were 5ʹ-AGGAAGA GAUGGAUACAAUTT-3ʹ (forward) and 5ʹ-AUUGUAUCCAUCUCUCUUCCUTT-3ʹ (reverse). The scrambled siRNA control sequences were 5ʹ-UUCUCCGAA CGUGUCACGUTT-3ʹ (forward) and 5ʹ-ACGUGACACGUUCGGAGAATT-3ʹ (reverse).

Overexpression of Pes1 in vitro

The purified plasmid of Pes1-flag and Lipofectamine 3000 were mixed in serum-free medium for 20 min. Then the mixture was added into the culture medium to transfect McArdle 7777 cells for 6 h. After being cultured in fresh medium for 24 h, the cells were divided into three groups for different treatments, including negative control (without transfection of Pes1 plasmid or any reagent), Pes1-plasmid and Pes1-plasmid plus β-HB. After being cultured for 24 h, cells were collected for subsequent assays of TG, TC, Western Blotting and qRT-PCR.

Chromatin immunoprecipitation

The binding of CHOP (C/EBP-homologous protein) to the Pes1 promoter, PES1 binding to the p300 and Caspase1 promoters were analyzed by chromatin immunoprecipitation (ChIP). Briefly, cells were crosslinked with 1% formaldehyde for 10 min, neutralized with 125 mM glycine pH 2.5 and washed in PBS. Nuclei were prepared by hypotonic lysis buffer (5 mM Pipes pH 6.8, 85 mM KCl, 0.5% NP40) and centrifugation, and resuspended in SDS lysis buffer, and incubated on ice for 10 min to be fully lysed. Chromatin was sonicated with bioruptor (Diagenode) to be 200–1000 bp average fragment size and cleared by centrifugation. The anti-CHOP, anti-PES1 antibodies or control rabbit IgG (AC005, ABclonal Technology Co., Ltd) was respectively added into an aliquot of 200 μL sonicated lysate, and then 20 μL washed protein A/G-agarose beads (sc-2003, Santa Cruz Biotechnology) was added. The mixture was rotated at 4 °C for 2 h, and then centrifuged at 1000g for 1 min at 4 °C to wash the beads. The washed beads were resuspended in TE buffer, vortexed 10 s and boiled for 10 min. The samples and sonicated lysates were treated with 1 μL of 20 mg/mL proteinase K. After being centrifuged at 12,000g for 5 min at 4 °C, the digested DNA was used for qRT-PCR assay. Primers for the CHOP binding site in Pes1 promoter, the PES1 binding site in the rat p300 and Caspase1 promoters were as follows: CHOP-Pes1 binding site (forward) 5ʹ-CTGGTACGTGGGTGCAGTTTGG-3ʹ, CHOP-Pes1 binding site (reverse) 5ʹ-CACACAGGGATGAACATAAGTGAGAGG-3ʹ; PES1-p300 binding site (forward) 5′-TCCTCTTGCTGTCTGACTTGTTTGAG-3′, PES1-p300 binding site (reverse) 5′-AAGATGTTGAGCCTGTTCTCTGAGTTC-3′; PES1-Caspase1 binding site (forward) 5′-GGAGCAGGGAAACGATGTATGT GAG-3′, PES1-Caspase1 binding site (reverse) 5′- TTGCCCTCAGGATCTTGTCTG TTTAAG-3′.

Co-immunoprecipitation

Every extracted protein stock solution from cultured cells or liver tissues was divided into two aliquots. The small part was directly used for input assay, and the remaining big portion was pre-cleared with protein A/G-agarose (sc-2003, Santa Cruz Biotechnology) for 2 h. The supernatant after pre-clearance was collected by centrifugation, and further divided into two equal portions. Ac-SREBP1c (acetylated SREBP-1c), p300 and nonimmune IgG (Santa Cruz, sc-2025) antibodies were respectively added in the supernatant (2 μg/per portion) and incubated at 4 °C overnight in rotating equipment. After centrifugation, the precipitates were collected and washed with cold lysis buffer for six times. The mixture of precipitates and loading buffer was boiled and then Ac-SREBP1c, p300, SREBP1c levels were detected using immunoblotting.

Liver-conditional knockout (CKO) Pes1 gene in mice

The parent of Pes1 CKO mice were generated by collaboration with Nanjing Institute of Biomedicine, Nanjing University (Jiangsu, China). Positive F1 generation mice were achieved by CRISPR–Cas9 technology. And hepatic Pes1 CKO mice were obtained by positive F1 generation crossing with ALB-Cre mice. Genotyping was performed by PCR using genomic DNA extracted from murine tails at 3–4 weeks. The mice were classified into wild-type littermates (fl/fl, wt/wt) and Pes1(−/−) (fl/fl, mut/wt) relying on genotype. The primer sequences for the transgenic Cre mice were as follows: Cre sense, 5ʹ-TTGGCCCCTTACCATAACTG-3ʹ; Cre antisense, 5ʹ-GAAGCAGAAG CTTAGGAAGATGG-3ʹ. The primer sequences for genotyping the Pes1 alleles were as follows: shared sense, 5ʹ-TTCCTCACCCTCAGCATTAGʹ; wild-type antisense, 5ʹ-GAGATAGACTGCAAGGCACTGT-3ʹ. Only male mice were used for all analyses (10–15 mice per group). After 16 weeks, mice were sacrificed after anesthetization to obtain the serum and livers for consecutive measuring TG, TC, and running Western Blotting and qRT-PCR.

Statistical analysis

Normally distributed data were expressed as mean ± SEMs. The continuous variables were analyzed either by Student’s t test, or by ANOVA followed by Student–Newman–Keuls q test for multiple comparisons. P < 0.05 was considered statistically significant. The data were analyzed using SPSS version 22.0 (IBM Corporation, Armonk, USA). Graphics were constructed using GraphPad Prism 7 (GraphPad Software, San Diego, CA).

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Disclaimer:

This article is autogenerated using RSS feeds and has not been created or edited by OA JF.

Click here for Source link (https://www.biomedcentral.com/)