Piglets and diets

All of works related to animal was conducted in accordance with the guidelines and regulations for the care and the use of experimental animals was approved by the Korea University Institutional Animal Care & Use Committee (Permission No. KUIACUC-2021-0021). We conducted all animal studies in accordance with the guidelines and regulations of the Animal Ethics Committee approved by Korea University (Seoul, Republic of Korea). The experiment was performed at a clean, controlled research farm in Cheonan, Republic of Korea, and pigs were supplied from the commercial farm in Sejong, Republic of Korea. A total of 140 early-weaned piglets (L × Y × D; 21 days old) were randomly allotted to four treatments according to their body weight (BW; initial mean BW: 6.57 kg). A pen was an experimental unit and each treatment had seven replications (5 pigs per pen). The dietary treatments consisted of CON (basal diet), SPL5 (5 mg/kg SPL supplementation), SPL10 (10 mg/kg SPL supplementation), and SPL15 (15 mg/kg SPL supplementation). The feed composition and calculated nutritional values are shown in Table 1. The feed and SPL were supplied by EASY BIO Inc. (Seoul, Republic of Korea). Feed and water were supplied ad libitum to the pigs during the experiment. The raising program consisted of three phases: phase 1, day 1–7; phase 2, day 8–21; phase 3, day 22–42. The BW and feed intake were measured biweekly to calculate average daily gain (ADG), average daily feed intake (ADFI), and feed efficiency (FE).

Table 1 Composition and nutritional value of basal dietsa

Sample collection

At the end of the experiment, 28 piglets (one piglet per pen, randomly selected) were sacrificed with a captive bolt and exsanguinated. Blood samples were collected from the jugular vein into heparin-coated plasma tubes (BD Vacutainer; Beckton Dickinson Rowa Denmark, Kongens Lyngby, Denmark) for analysis of biochemical markers (glucose, triglyceride, total cholesterol, blood urea nitrogen, albumin, and creatinine). Thereafter, jejunal and cecal samples were obtained, immediately frozen using dry ice, and stored at − 80 °C until further analysis. In addition, 10 mm of central parts of the jejunum were fixed in a 4% formalin solution for histological analysis. The farm owner allowed all tissue samples to be collected.

Blood biochemical markers

The concentrations of glucose, triglyceride, total cholesterol, blood urea nitrogen, albumin, and creatinine in the plasma samples were determined using commercial kits (EMBIELTM, Seoul, Korea) according to the manufacturer’s instructions. The absorbance of samples was measured using a spectrophotometer (Zenyth 200rt; Biochrom, Berlin, Germany) at a specific wavelength, and the concentration of samples was calculated using the standard curve of each biomarker.

Histological analysis of the jejunum

The fixed jejunum samples were embedded into paraffin blocks, and 5 μm cross-sections were prepared using a rotary microtome (CUT 5062; SLEE Medical, Mainz, Germany). The jejunum sections were then stained with hematoxylin and eosin and Alcian blue. Subsequently, a total of 15 villi and 15 crypts were randomly selected per experimental unit, and a single observer measured the villus height and crypt depth, and counted the number of goblet cells.

RNA extraction from the jejunum and cecum

Trizol® (Invitrogen, Grand Island, NY, USA) was used to extract total RNA from jejunal and cecal samples, and a Nanodrop spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) was used to determine the concentration and purity of extracted RNA. Consequently, a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Carlsbad, CA, USA) was used to synthesize cDNA samples according to the manufacturer’s instructions.

RNA analysis and cecal bacteria analysis by qRT-PCR

Gene expression levels of inflammatory cytokines (interleukin-8, IL-8; interferon-γ, IFN-γ; tumor necrosis factor-α, TNF-α; and interleukin-10, IL-10) and tight junction proteins (zonula occludens-1, ZO-1; occludin, OCLD; and claudin 1, CLDN1) in jejunal samples were determined by qRT-PCR using a RealHelixTM Premier qPCR kit (NanoHelix, Daejeon, Korea) with a StepOnePlus Real-Time PCR System (Applied Biosystems). Additionally, the expression levels of mucin 2 (MUC2) were also determined in both the jejunum and cecum. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. The 2-ΔΔCT method was used to quantify relative mRNA expression levels. The primers for the target genes are listed in Table 2.

Table 2 Oligonucleotide primers used in qRT-PCR analysisa

Cecal gDNA extraction and quantification

DNA was extracted using a DNeasyPowerSoil Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The extracted DNA was subsequently quantified using Quant-IT PicoGreen (Invitrogen).

Library construction and sequencing

The sequencing libraries were prepared according to the Illumina 16S Metagenomic Sequencing Library protocols to amplify the V3 and V4 regions. The input gDNA, 2 ng, was PCR amplified using 5× reaction buffer, 1 mM dNTP mix, 500 nM each of the universal F/R PCR primers, and Herculase II fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, USA). The cycling conditions for the first PCR were 3 min at 95 °C for heat activation, and 25 cycles of 30 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C, followed by a 5 min final extension at 72 °C. The universal primer pair with Illumina adapter overhang sequences used for the first amplification were as follows: V3-F: 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGG CWGCAG-3′, V4-R: 5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTAC HVGGGTATCTAATCC-3′. The first PCR product was purified using AMPure beads (Agencourt Bioscience, Beverly, MA, USA). Following purification, 2 μL of the first PCR product was PCR amplified for final library construction containing the index using NexteraXT Indexed Primer. The cycling conditions of the second PCR were the same as those for the first PCR, except those 10 cycles were run. Thereafter, the PCR product was purified using AMPure beads. The final purified product was then quantified using qPCR according to the qPCR Quantification Protocol Guide (KAPA Library Quantification kits for Illumina Sequencing platforms) and qualified using the TapeStation D1000 ScreenTape (Agilent Technologies Deutschland GmbH, Waldbronn, Germany). Paired-end (2 × 300 bp) sequencing was performed at Macrogen using the MiSeq™ platform (Illumina, San Diego, CA, USA).

Cecal short-chain fatty acids (SCFA) measurement

Gas chromatography-mass spectrometry (GC-MS) is used to determine the concentration of short-chain fatty acids (SCFA) in the cecal contents according to the method suggested by Furusawa [23]. SCFA concentrations were quantified by comparing their peak areas with the standards.

Statistical analysis

Growth performance was analyzed using the GLM procedures of SAS (1989), and polynomial contrasts (linear, quadratic, and cubic) were used to test the effect of SPL supplementation levels. The other physiological parameters (serum biochemical markers, gut histological data, gene expression levels in the jejunum and cecum, gut microbial population, and cecal SCFA concentrations) were analyzed using analysis of variance. All data analyses were conducted using SAS 9.4 (SAS Institute, Cary, NC, USA). Significant differences between the treatments were determined using Duncan’s multiple range tests at a p < 0.05 level of significance.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Disclaimer:

This article is autogenerated using RSS feeds and has not been created or edited by OA JF.

Click here for Source link (https://www.biomedcentral.com/)