Microbes and plants

Bacteria Pt-3 was isolated from tea rhizosphere in Xinyang, Henan province, China. Seven important phytopathogens including Aspergillus flavus, Fusarium graminearum, Alternaria alternata, Magnaporthe oryzae, Aspergillus fumigatus, Colletotrichum graminicola and Botrytis cinerea were isolated from diseased plants and stored in our lab [23, 24]. Peanut (cultivar Silihong) and maize (cultivar Kunyu) seeds were purchased from supermarket. The application of these seeds in our test was permitted in China, and complied with local legislation.

Isolation of microbe with P-solubilizing activity

Soil samples collected from tea rhizosphere about 10 cm in depth were stored at 4 °C, and used in less than 4 days. For bacteria screening, 1 g soil was placed in 2 ml tubes containing 1 ml sterilized water. The suspension was mix well on vertex for 5 min, then serially diluted to 10− 6. One hundred microliters of dilution was spread on NA medium, and cultured at 37 °C for 48 h. The bacteria clones with different phenotypes appeared in NA medium were picked out and streaked on a new NA medium for further tests.

Two kinds of phosphate medium were used in the tests for screening P-solubilizing bacteria. The inorganic P medium contained (NH4)2SO4 0.5 g, MgSO4 0.3 g, NaCl 0.3 g, Ca3(PO4)2 8.0 g, glucose 10.0 g, 11% MnSO4 1 mL, 1% FeSO4 1 mL, agar 20 g, 1000 ml distilled water, pH = 7.2. The organic P media included (NH4)2SO4 0.5 g, NaCl 0.3 g, KCl 0.3 g, CaCO3 5 g, 11% MnSO4 1 mL, 1% FeSO4 1 mL, Soybean lecithin 0.8 g, yeast extraction 0.8 g, agar 20 g, 1000 ml distilled water, pH = 7.2. The medium was autoclaved at 121 °C and 1.01 MPa for 30 min, cooled to room temperature and poured into petri dishes (9 cm in diameter) with 20 ml in each respectively. One medium hole was punched out by a manual disk puncher with a diameter of 5 mm. Obtained microbe suspension (20 μL) collected from NA medium was inoculated into each hole in the medium (organic and inorganic P media). All inoculated media were cultured at 30 °C and darkness for 5 days. Bacterial clones with clear halo zone in phosphate media were considered as PSB and selected for further use. The P-solubilizing activity of each microbe was conducted for two times, and the phosphate solubilizing index (PSI) was calculated as the following equation [20, 21].

$$mathrm{PSI}=left(mathrm{colony} mathrm{diameter}+mathrm{halozone} mathrm{diameter}right)/mathrm{colony} mathrm{diameter}times 100.$$

P-solubilizing activity of Pt-3 in liquid broth and soil

Pt-3 was cultured in NA medium for 48 h. The fresh bacteria bodies were collected and adjusted to 108 cfu/mL in sterilized water. To analyze the P-solubilizing activity of Pt-3, 100 μL of bacteria suspension was inoculated into 40 mL of the liquid inorganic P medium ((NH4)2SO4 0.5 g, MgSO4 0.3 g, NaCl 0.3 g, Ca3(PO4)2 8.0 g, glucose 10.0 g, 11% MnSO4 1 mL, 1% FeSO4 1 mL, 1000 ml distilled water with pH 7.2) in 100 ml flask. The media without bacteria were used as control. All flasks were placed at 30 °C and 100 rpm for 20 days. One milliliter of suspension was collected from the flask every 6 days. The suspension was centrifuged at 8000 rpm for 15 min, and the supernatant was transferred into a new tube for PO43− analysis. The soluble PO43− in the supernatant cultures was determined with a Segmented Continuous Flow Analyzer (Futura, Alliance, France) at a wavelength of 420 nm [2].

To determine the P-solubilizing activity of bacteria in soil, soil sample was collected from tea rhizosphere of 10 cm in depth, dried at room temperature and sieved through 40-mesh screen. 1.70 kg soil was filled into a plastic bag, 15% (v/w) of inorganic P medium was added into each soil sample and autoclaved at 121 °C for 20 min (three times). Strain Pt-3 at OD 0.354 was inoculated to soil samples at 5% (v/w). Sterilized water was used as control. Each test was conducted for three times, and all soil samples were cultured at 28 °C and darkness for 30 days. The soil (10 g) was collected from each bag every 6 days and used for PO43− quantitative analysis.

The soil samples were re-suspended in 10 mL sterilized water, mixed at vortex for 10 min, and centrifuged at 3500 rpm for 10 min. The supernatant was then filtered through a 0.45 μm filter. Released PO43− was measured using the method described above. The P-solubilizing activity of Pt-3 in liquid and soil conditions were conducted for two times with three replication in each.

Plant growth promoting activity of Pt-3 on maize seedling

Soil sample was collected from the rhizosphere of tea plant about 5-10 cm in depth. The soil sample was dried at room temperature, sieved through a mesh of 2.00 mm in side length. Then, the soil was filled in plastic bags and autoclaved at 121 °C and 30 min for 3 times. After cooling to room temperature, the liquid P solubilizing medium was added into the soil samples (relative to the soil 15% v/w). Then, the soil was equally separated into six parts, and placed into six pots (19.2 cm in diameter, 14.2 cm in height) with 1.8 kg in each. Pt-3 suspension was inoculated into three pots and blended well with a stirring rod. The other three pots inoculated with sterilized water were used as control.

Maize seeds were surface sterilized in 75% ethanol for 3 min, rinsed and soaked with sterilized water for 30 min, then placed on moistened filter paper for germination. The germinated seeds with same bud length were picked, and sowed into the pots filled with soil. Three pots were used in each treatment, and four seeds were planting in each pot. All pots were maintained in the open air and occasionally watered with sterile water for 30 days. Finally, the maize seedlings were obtained, and the parameters (including plant height, leaf and root length, leaf number and width, dry weight) were measured.

Molecular identification of strain Pt-3

The genomic sequence of Pt-3 was extracted by Tris-HCl (Amresco) and EDTA (Amresco) methods [3]. The 16S rRNA sequences were amplified by PCR methods using the universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1541R (AAGGAGGTGATCCAG CCGC) [27, 28]. The PCR conditions used were as follows: initial denaturation at 94 °C for 5 min; followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 40 s; then 72 °C for 10 min. PCR products were analyzed by gel electrophoresis and purified for sequencing analysis. The sequences were aligned in GenBank database. The obtained 16S rRNA sequences of bacterial strain with similarity over 95% were selected for further phylogenic tree analysis. Twelve strains including Pt-3, Serratia plymuthica BSP25, K-7, UBCF13, T237, ZC06-1, AG2105, SFC20131227, Serratia liquefaciens CPAC53, ATCC27592, and Serratia entomophila Mor4.1, DSM12358 were used for phylogenetic tree analysis. The tree was constructed using the MEGA software with the neighbor-joining method [2, 29, 30].

Biochemical and biophysical analysis of strain Pt-3

Strain Pt-3 was cultured on commercial BUG medium (Biolog, Hayward, CA) at 28 °C for 24 h. The fresh bacteria clone was inoculated into solution A (Biolog, Hayward, CA) and adjusted to percent transmittance 95% through Biolog Turbidimeter (Biolog, Hayward, CA). The bacteria suspensions were mixed well and distributed into Microplate (Biolog, Hayward, CA) with 100 μL in each hole. The plates were cultured at 28 °C for 12 h. The biochemical results of Pt-3 were recorded through Biolog Gen III system (Biolog, Hayward, CA) [24].

Broad spectrum antifungal activity of strain Pt – 3

The antifungal activity of strain Pt-3 was analyzed through FTF dual cultural tests in two Petri dishes. Pt-3 was cultured on the surface of NA plate at the bottom. Fresh fungal strains were inoculated to the center of PDA plate in the top. The PDA plate was placed face-to-face on the top of NA plate. The PDA plate with fungal co-cultured with NA plate without Pt-3 was used as control. All plate pairs were sealed with tapes and cultured at 28 °C and darkness for 7 d. The inhibition of Pt-3 against pathogenic fungi was conducted for two times, and the inhibitory rate was calculated based on the following formula: Inhibitory rate (%) = (mycelia diameter of the control- mycelia diameter of the Pt-3) / diameter of the control × 100.

Effect of active charcoal on inhibitory activity of Pt-3

Pt-3 could inhibit the growth of fungal in face-to-face cultural tests. To further prove the antifungal activity of volatiles from Pt-3, active charcoal (5 g) was added in the tests to verify the fumigation efficacy of VOCs from Pt-3. Here, four pairs of Petri dishes were used: (a) A. flavus inoculated to the center of PDA plate. (b) Pt-3 on NA against A. flavus inoculation on PDA. (c) Active charcoal in Petri dish against A. flavus on PDA. (d) active charcoal, Pt-3 on NA against A. flavus on PDA. All plates were incubated at 28 °C for 5 days [22]. Similarly, the diameters of the fungi on PDA plate were recorded and the inhibitory rate was calculated as before.

Identification of VOCs from Pt-3 by GC-MS

VOCs from Pt-3 showed broad antifungal activity. To further identify the predominant compounds in VOCs, the VOCs was enriched by Solid-phase micro-extraction (SPME), and further identified by Gas Chromatography tandem Mass Spectrometry (GC-MS/MS). Pt-3 (100 μl, 108 cfu/ml) was spread on NA medium surface (40 ml) in a 100 ml flask. The flask was sealed with plastic membranes. NA medium without bacteria was used as control. All flasks were cultured at 28 °C and darkness for 48 h [22]. Flasks were transferred to a pre-heated 40 °C water-bath and allowed to equilibrate for 30 min. The adsorption head of SPME was injected into the flaks and absorbed for 40 min, then used for GC-MS analysis [31].

For GC-MS analysis, the column was DB-5 MS capillary column (30 m × 0.25 mm ID, 0.25 mm thickness film). Helium was used as carrier gas at the flow rate of 1 ml/min. The inlet temperature was 250 °C. The oven temperature was set as follows: 40 °C for 3 min, gradually increased to 160 °C at the rate of 3 °C/min, and maintained for 2 min. Finally, the temperature was increased to 220 °C at 8 °C/min, and lasted for 3 min [32, 33]. For MS, the spectrometers were operated in electron-impact (EI) mode, the scan range was 50–550 amu. The inlet, ionization source and quadrupole temperature were 300, 230 and 150 °C, respectively. The compounds identified in the spectrometry profiles of Pt-3, not presented in control samples were considered to be the final analytes. The compounds were aligned in National Institution of Standards and Technology (NIST 11) database [32, 33]. The retention time and mass spectrum of identified compounds was compared with commercial standards for final qualitative analysis.

Scanning electron microscope analysis

A. flavus mycelium was inoculated to the center of PDA medium and cultured at 28 °C for 5 days. Fresh conidia on PDA surface were washed off with sterilized water and filtrated through two layers of gauze, and diluted to a concentration of approximately 105/ml for peanuts inoculation tests [22].

Peanut seeds (100 g) of uniform size were placed in 250 ml flasks and autoclaved at 121 °C and 1.01 MPa for 20 min. Ten ml sterilized water containing A. flavus conidia (104 cfu/ml) was added to the flask, mixed well and adjust to water activity (aw) 0.9. The peanut seeds inoculated with A. flavus were divided in two petri dishes. One dish was challenged with Pt-3 (grown on NA plate) with face-to-face method. The other dish challenged with NA medium was used as control. All Petri dishes were incubated at 28 °C for 5 days. The peanut seeds were fixed in 0.1% osmic acid for 1 h. Then, a small piece of the peanut coat about 3 × 3 mm was peeled off, affixed to stubs, coated with gold and investigated through scanning electron microscope [23, 31].

Data analysis

All experiments were carried out at least in twice and results were reported as means ± standard deviations. The significant differences were determined using Student’s T tests (p < 0.05) following one-way analysis of variance (ANOVA). The statistical analysis was performed using SPSS 16.0 software (SPSS Inc., Chicago, USA).

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Disclaimer:

This article is autogenerated using RSS feeds and has not been created or edited by OA JF.

Click here for Source link (https://www.biomedcentral.com/)