Porcine PSC culture

Porcine PSCs were cultured on a layer of mitotically-inactivated mouse STO feeder cells (plated on gelatinised tissue culture plastic at a density of 4 × 104/cm2) in pEPSC medium [27]. PSCs were passaged by washing once with PBS then incubating for 3 min in 0.025% trypsin/EDTA at 37 °C/5% CO2. Cells were dispersed to single cell by pipetting and pelleted in an equal volume of feeder medium [G-MEM (Sigma, #G5154), 10% FBS (Gibco, #10500064) 1xNEAA (Gibco, #11140035), 1 mM sodium pyruvate (Gibco, #11360039), 2 mM L-glutamine (Gibco, #25030024), 0.1 nM β-mercaptoethanol (Gibco, #31350010)] at 300×g for 4 min. Cells were plated at a density of 2-3 × 103/cm2 in pEPSCM medium [27] containing the Rho-associated coiled kinase (ROCK) inhibitor Y-27632 (5 μM, Stemcell Technologies, #72304). Cells were fed the following day with pEPSCM without Y-27632 then fed daily. PSCs were passaged every 3–5 days. Two porcine PSC lines (F1 and K3) were used to generate in vitro-derived macrophages [27].

Bovine PSC culture

Bovine PSCs (line #A) [28, 31] were cultured in bESC culture medium (bESCM) [N2B27 medium, 1xNEAA, 1xGlutamax (Gibco, #35050061) 0.1 nM β-mercaptoethanol, pen/strep (Gibco, #15140122), 10% AlbumiNZ low fatty acid BSA (MP Biochemicals, #0219989925), 20 ng/μl rhFGF2 (Peprotech, #100-18B), 20 ng/μl rhActivinA (Qkine, Qk001), 2.5 μM IWR-1 (Sigma, #I0161)] on a layer of mitotically-inactivated MEFs (plated on gelatinised tissue culture plastic at a density of 6 × 104/cm2). The MEFs were washed twice with PBS prior to plating PSCs in bESCM. For passaging, PSCs were incubated 1 h with bESCM containing 10 μM Y-27632 prior to dissociating then washed twice with PBS and incubated for 3 min in TrypLE Express (Gibco, #12604013) at 37 °C/5%CO2. Cells were dispersed to single cell by pipetting and pelleted in 6x volume of bESCM at 300×g for 4 min. Resuspended cells were plated at 1:5 in bESCM + 10 μM Y-27632 overnight then changed to bESCM without Y-27632 and fed daily. Bovine PSCs were passaged every 3–4 days.

Macrophage differentiation

PSCs were passaged as normal then pre-plated on a gelatinised 6-well tissue culture plate for 10–15 min at 37 °C/5% CO2 to remove feeder cells. Floating PSCs were pelleted at 300×g for 4 min, washed in PBS and resuspended in Mesoderm Induction medium containing StemPro (Thermo, #A1000701), 20 ng/ml rhbFGF (Qkine, #Qk027), 50 ng/ml rhBMP4 (R&D, #314-BP), 50 ng/ml rhVEGF (R&D, #293-VE), 20 ng/ml rhSCF (R&D, #255-SC), and pen/strep containing 5 μM Y-27632. Typically, 2000–4000 PSCs were dispensed per well into a 96-well V-bottomed plate containing 100 μl Mesoderm Induction medium with 5 μM Y-27632 and centrifuged at 1000×g for 3 min. The aggregated EBs were fed the next day with Mesoderm Induction medium without Y-27632 then daily thereafter. On day 4, medium was aspirated from the wells and 10–15 EBs transferred to a gelatinised 6-well tissue culture plate containing Macrophage Induction media. For porcine PSCdM differentiation, EBs were plated in medium composed of X-Vivo 15 (Lonza, #LZBE02-060F), 2 mM Glutamax, 50 nM β-mercaptoethanol, pen/strep, 100 ng/ml recombinant porcine M-CSF (Roslin Technologies), and 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). For bovine PSCdM differentiation, EBs were plated in medium composed of RPMI-1640 (Sigma, #R5886), 10% FBS, 2 mM Glutamax, 0.1 nM β-mercaptoethanol (cRPMI medium) containing 100 ng/ml rpM-CSF (Roslin Technologies), and 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium. Early signs of macrophage production can usually be detected at day 9–12 in the form of a few attached vacuolated cells or clusters of round cells with small projections. Floating immature macrophages can typically be harvested around day 20 and collected every 4 days until approximately day 40. Harvested immature macrophages can be matured by plating cells on non-coated tissue culture plastic in X-Vivo 15, 2 mM Glutamax, pen/strep, 100 ng/ml rpM-CSF (Macrophage Maturation medium).

Phagocytosis assay

PSCdMs and PAMs were plated in triplicate on non-coated 96-well tissue culture plates at 1 × 105/well in 100 μl Macrophage Maturation medium or RPMI-1640 (Sigma, #R5886), 10% FBS, 2 mM Glutamax, and 0.1 nM β-mercaptoethanol (cRPMI medium) respectively for 48 h. On the day of the assay, the medium was aspirated and replaced with 100 μl OptiMEM containing 100 μg/ml pHrodo Red Bioparticles (Thermo, #P35364). Cells were incubated at 37 °C/5% CO2 and fluorescence measured at T0 and every hour thereafter on a BioTek Gen 5 plate reader. After 8 h, the cells were dissociated by scraping with a pipette tip and fluorescence was quantified by flow cytometry. Cells with no beads added and beads alone served as negative controls.

LPS/Poly(I:C) induction

Cells were plated at a density of 5 × 104/cm2 on tissue culture plastic in Macrophage Maturation medium for 48 h. Medium was replaced with fresh Macrophage Activation medium containing either Lipopolysaccharides (LPS, 200 ng/ml, from Escherichia coli O111:B4, Sigma #L4391) or Poly(I:C) (25 μg/ml, Tocris #4287) and incubated for 4 h prior to lysis for RNA recovery.

RT-qPCR

RNA was prepared using Qiagen RNeasy kit (#74104) following the manufacturer’s protocol including the recommended on-column DNase treatment. cDNA was synthesised from 0.2–1 μg of RNA using Agilent’s Multitemp cDNA Synthesis kit (#200436) at 42 °C following the manufacturer’s instructions. The final cDNA volume was made up to 1 ml with nuclease-free water. Each RT-qPCR reaction consisted of 8 μl of diluted cDNA plus a mastermix consisting of 10 μl Agilent Brilliant III SYBR green (#600883), 0.4 μl Reference dye (2 μM) and 0.8 μl each of forward and reverse primers (RPL4 was used as the housekeeping gene to normalise expression—see list of primers). The reaction was performed on a Stratagene MxPro3005P QPCR instrument using the following cycle parameters: one cycle of 95 °C for 2 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. A final cycle of 95 °C for 1 min, 60 °C for 30 s and 95 °C for 15 s was performed to establish a dissociation curve.

Cell surface staining

Cells were blocked in PBS/2% FBS, on ice for 30 min. 2 × 105 cells/well were transferred to a 96-well V-bottomed plate and pelleted at 300×g, 4 min, 4 °C. The supernatant was removed by inverting the plate. The pellet was resuspended with 25 μl of diluted, conjugated antibody and incubated in the dark, on ice for 30 min. The cells were then pelleted at 300×g, 4 min, 4 °C and washed twice with 75 μl PBS. The final pellet was resuspended in 100 μl PBS; 100 μl SYTOX Blue Nucleic Acid Stain (5 μM, ThermoFisher #S11348) was added immediately prior to flow cytometer analysis to allow for live/dead cell identification. Antibodies used were CD14 (Biorad, #MCA1218F, 1:50) with isotype control (Sigma, #SAB4700700), CD16 (Biorad, #MCA1971PE, 1:200) with isotype control (Biorad, #MCA928PE), CD163 (Biorad, #MCA2311F, 1:100) with isotype control (Sigma, #F6397), CD169 (Biorad, #MCA2316F, 1:100) with isotype control (Sigma, #F6397) and CD172a (Southern Biotech, #4525-09, 1:400) with isotype control (Biorad, #MCA928PE).

Toxoplasma infection and staining

PAMs and PSCdMs were plated 48 h prior to infection at 8 × 105/well in a 12-well tissue culture plate in cRPMI medium. The cells were fed with cRPMI 24 h before infection. The next day the medium was aspirated and the cells infected with Toxoplasma gondii at MOI = 1 in cRPMI for 24 h at 37 °C/5%CO2. 24 h post-infection the cells were collected using a cell scraper and pelleted at 600×g for 4 min then washed in 500 μl PBS. One half was lysed for genomic DNA recovery to determine Toxoplasma DNA copies and the other half used to prepare RNA for RT-qPCR analysis.

Salmonella enterica serovar Typhimurium infection and staining

PAMs and PSCdMs were plated 48 h prior to infection at 5 × 105/well in a 12-well tissue culture plate in cRPMI. The day before infection, a single colony of Salmonella enterica serovar Typhimurium strain 4/47, expressing EGFP from plasmid pFVP25.1 [32], was cultured for 16 h in 3 ml LB medium + 100 μg/ml Ampicillin. The OD600 absorbance was measured on a spectrophotometer and used to determine the bacterial cell concentration using the online tool http://www.labtools.us/bacterial-cell-number-od600/. The cells were washed twice with PBS and infected with bacteria diluted in cRPMI medium at an MOI = 2 for 30 min at 37 °C/5% CO2. Following two washes with PBS, the cells were then treated with 100 μg/ml gentamicin in cRPMI for 1 h at 37 °C/5% CO2 to kill extracellular bacteria. Surviving intracellular bacteria were harvested at 0 h and 3 h after gentamicin treatment by washing the cells twice with PBS then lysing with 1% TritonX100. Ten-fold serial dilutions were plated on to LB/Ampicillin culture plates and incubated overnight at 37 °C. Colonies were counted the next day. For staining, cells were fixed on glass coverslips after gentamicin treatment in 4% Formaldehyde for 15 min then permeabilised in PBS/0.1% TritonX100 for 10 min before staining with Phalloidin AF647 (1:1000) and DAPI (1:10,000) in PBS at room temperature for 30 min in the dark. Cells were washed twice with PBS before mounting on glass slides and imaging on a Leica LSM10 confocal microscope.

Escherichia coli infection

PAMs and PSCdMs were infected with Escherichia coli strain TOP10 at a MOI = 10 using the same protocol as for Salmonella infection and surviving bacteria harvested at 0 h and 2 h after gentamicin treatment.

PRRSV infection and staining

PAMs and PSCdMs were plated on non-coated tissue culture plates in cRPMI at a density of 1 × 105/cm2 24 h prior to infection. Where indicated macrophages were pre-treated with poly(I:C) (25 μg/ml) for 3 h prior to infection. Cells were infected with PRRSV (SU1-Bel) at MOI = 1 in cRPMI for 2 h at 37 °C. The inoculum was then removed, and the cells fed with fresh cRPMI. At 19 hpi cells were washed twice with PBS and detached using a cell scraper. Cells were fixed in 4% Formaldehyde for 15 min then permeabilised with 0.1% TritonX100/PBS for 10 min. After washing twice with PBS, the cells were blocked in 5%FBS/PBS for 30 min prior to incubating with primary antibody (SDOW-17A, 1:5000) for 45 min in blocking solution. Following two washes with PBS, the cells were then incubated with secondary antibody (Goat α-mouse AF488, 1:5000) for 1 h in the dark before staining with Phalloidin AF647 (1:1000) and DAPI (1:10,000) for 30 min in the dark. After two washes with PBS, the cells were analysed by flow cytometry.

ASFV infection and growth assays

Porcine monocyte macrophages (PMMs) were harvested from heparinised blood taken from pigs housed at the APHA under housing and sampling regulations, licence PP1962684, approved by the APHA Animal Welfare and Ethical Review Board and conducted in accordance with the Animals (Scientific procedures) Act UK. Blood was centrifuged and plasma, leukocytes (buffy coat) and erythrocyte fractions harvested. The leukocytes were washed in PBS, followed by two washes with BD Pharm Lyse (#555899). After two further washes in PBS, cells were re-suspended in RPMI supplemented with 20% v/v autologous plasma, harvested from the initial centrifugation step, and 100 U/ml Penicillin-Streptomycin (Gibco, #15140122). Cells were incubated in 96-well plates at 37 °C/5% CO2 for 48 h prior to infection with ASFV. Infections with ASFV were performed at the APHA in biosecure containment laboratories licenced for handling of level 4 specified animal pathogens. ASFV strain Armenia 07 diluted in RPMI was added to PSCdMs, PAMs and PMMs at an MOI of 1 in 96-well plates. After 1 h incubation at 37 °C, the virus inoculum was removed and, for quantification of viral replication by qPCR, was replaced with 200 μl of Macrophage Maturation media. For observation of ASFV infection by detection of haemadsorbance additional wells were set up in which the virus inoculum was removed and replaced with 200 μl Macrophage Maturation medium supplemented with 1% v/v porcine erythrocytes and 1% porcine plasma. Plates were incubated at 37 °C/5% CO2 for up to 5 days. Formation of HAD rosettes due to haemadsorbance of erythrocytes to infected macrophages was observed by light microscopy. To quantify ASFV replication and release into the supernatant 140 μl of media was removed from wells after 0, 24 and 48 h and nucleic acid extracted using Qiamp viral RNA mini extraction kit (Qiagen, #52904). Viral DNA levels were quantified by qPCR using primers and probe that detect the ASFV VP72 gene [53] with the Quantifast Pathogen PCR kit (Qiagen) and the following cycle conditions: 1 × 95 °C for 5 min followed by 50 cycles of 95 °C for 15 s, 60 °C for 1 min The copies of viral genome were determined by comparison Cq values to those of a standard comprised of a dilution series of the plasmid pASFV-VP72 encoding a fragment of the VP72 gene.

ASFV infection with strain Benin 97/1 was performed at the Pirbright Institute essentially as described previously [54]. ASFV infection was monitored by formation of HAD rosettes, and immunocytochemical detection of ASFV VP72 expression [55]. ASFV replication was measured by TCID50 assay and calculated using the Spearman-Karber method.

Gene editing REX1-EGFP knock-in

The pig REX1 targeting vector was constructed in two stages. First, the homology arms were amplified from porcine PSC genomic DNA using primers with tails containing the inverted guide sequence (5′HA+Guide_Forward:CTTCTTTCACTGATTTGTATTGGTTCAAGGAGAGCGCAAAACTA,3′HA+guide_Reverse:CTTCTTTCACTGATTTGTATTGGAGTTGATTCAAATGGATTGACA). The PCR product was then TA-cloned into the pCR4-TOPO TA vector backbone (ThermoFisher #450071) and linearised by inverse PCR using primers positioned either side of, and designed to exclude, the Rex1 STOP codon (HA3_inv_For AAGAAGACTGAAAATAATCC, HA3_inv_Reverse:CTGATTTGTATTGGCCTTTG). In addition, a T2A-EGFP-IRES-PURO-bGHpA cassette was amplified by PCR using primers with 15 bp tails homologous to the sequence either side of the Rex1 STOP codon (T2ARex1_Forward:GCGAATACAAATCAGGGCTCCGGAGAGGGCAGAG, bGHpaRex1_Reverse:ATTTTCAGTCTTCTTCCATAGAGCCCACCGCATCC). Second, the linearised homology arms and amplified reporter/selection cassette were assembled by Gibson assembly (NEB, #E2621S) and individual clones were sequence verified. A CRISPR/Cas9 guide sequence was identified using Benchling (www.benchling.com) that generates a double-strand break 8 bp upstream of the pig REX1 STOP codon (Rex1_363 CTTCTTTCACTGATTTGTAT). The sgRNA was synthesised by Synthego. For editing, 7.5 μl sgRNA (100 μM) was combined with 5 μl Cas9 protein (20 μM, Synthego) at room temperature for 10 min to form ribonucleoprotein complexes (RNPs), then 1 μg targeting vector was added to the RNPs and made up to 30 μl with P3 Primary Cell Solution (82 μl Nucleofector Solution + 18 μl Supplement per 100 μl) and kept on ice prior to transfection. Porcine PSCs were passaged as normal and 5 × 105 cells were resuspended in 70 μl of Amaxa P3 Primary Cell Solution. The RNP complex was mixed with the cells, transferred to a transfection cuvette then nucleofected on an Amaxa 4D Nucleofector using program CG-104. The cells were resuspended in pEPSCM + ROCKi and plated over two wells of a 6-well plate containing mitotically-inactivated STO feeder cells. Medium was changed the next day for pEPSCM without ROCKi. Seventy-two hours post-transfection, the cells were passaged and plated at 2 × 104/cm2. Puromycin selection (0.2 μg/ml) was added 24 h later. After 10 days, six colonies were picked and passaged as normal into a 96-well tissue culture plate. Clones were expanded and screened by PCR for evidence of editing. Correctly targeted clones were identified at both the 5′ an 3′ ends of the integration site by PCR amplification of genomic DNA using 5′ primers (xF1 – GTTTTCTGAGTACGTGCCAGGC, iR1 – CGGGTCTTGTAGTTGCCGTCGT) and 3′ primers (iF2 – TGGGAAGACAATAGCAGGCATG, xR3 – CACACCCCGCCCAACTGCTG) under the following cycle conditions: − 98 °C for 1 min then 32 cycles of 98 °C for 10 s, 69 °C for 30 s and 72 °C for 1 min followed by a final extension of 72 °C for 10 min. For each screen, one primer was located outside the homology arm sequence and the other within the reporter/selection cassette. Targeted fragments of 885 bp and 1213 bp were expected for the 5′ and 3′ screens respectively.

Gene editing IRF3 deletion

A pair of CRISPR/Cas9 guide sequences was designed to delete the pig IRF3 coding sequence. Guide sequences were identified using Benchling (www.benchling.com) and synthesised by Synthego (IRF3_1094 CGAGGCTTCTGAGTTCCCAT, IRF3_5441 ACATGGATTTCTAGGCCGCT). For editing, 3.75 μl of each sgRNA (100 mM) was combined with 5 μl Cas9 protein (20 mM, Synthego) at room temperature for 10 min to form RNPs then 17.5 μl P3 Primary Cell Solution added and the RNPs kept on ice prior to transfection. Porcine PSCs were passaged as normal and 5 × 105 cells were resuspended in 70 μl of Amaxa P3 Primary Cell Solution. The RNP complex was mixed with the cells, transferred to a transfection cuvette then nucleofected on an Amaxa 4D Nucleofector using program CG-104. The cells were resuspended in pEPSCM + ROCKi and plated over two wells of a 6-well plate containing mitotically-inactivated STO feeder cells. Medium was changed the next day for pEPSCM without ROCKi. Seventy-two hours later, the cells were passaged and plated at low density (2.5 × 102–1 × 103/cm2). After 9–11 days, 80 colonies were picked and passaged as normal into a 96-well tissue culture plate. Clones were expanded and screened by PCR for evidence of editing. Genomic DNA was PCR amplified using a pool of two forward primers (scrnF1 – AGGCCGTCTGTTTGGGAGGAA, Ex8F1 – TTGTCCCCATGTGTCTCCGG) and one reverse primer (scrnR1 – TGACAGACAGGACGTTTAGGCA) under the following cycle conditions:− 98 °C for 1 min then 32 cycles of 98 °C for 10 s, 68 °C for 30 s and 72 °C for 1 min followed by a final extension of 72 °C for 10 min. Two wild-type fragments of 5,311 bp and 640 bp, and an edited fragment of 964 bp were expected although the 5,311 bp fragment failed to amplify under these conditions.

Lentivirus packaging

HEK293T cells were grown to 80% confluence in a T175 flask then transfected with 15 μg lentiviral plasmid together with 12 μg psPax2 and 3 μg pVSV packaging plasmids using 15 μl Lipofectamine 2000. The medium containing lentivirus was harvested at 24 h and 48 h. The medium was stored at 4 °C until all harvests were collected then pooled and filtered through a 0.45 μm filter. Filtered lentivirus was either stored in aliquots at − 80 °C or further purified and concentrated using the Lenti-X Maxi Purification kit (Takara #631234) according to the manufacturer’s instructions. Concentrated lentivirus was stored in aliquots at −80 °C.

Lentiviral transduction

Porcine PSCdMs were plated in Macrophage Maturation Medium at 3 × 105/cm2. Seventy-two hours later, the medium was removed, and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000×g for 1 h at 32 °C). Following spinfection, the medium was replaced with fresh Maturation Medium, and the cells incubated at 37 °C/5 % CO2. The cells were imaged and analysed by flow cytometry 7–8 days post-transduction. For assessing transduction efficiency, a CMV-GFP-Puro-expressing lentivirus (Addgene #17448) was used at MOI = 1. For editing of CD163, a dual guide RNA lentivirus (Addgene #67974) was modified to express the CD163 guides SL26 and SL28 [41] by cloning a gBlock containing the crRNASL26-tracrRNA-mU6-crRNASL28 sequence into the BbsI site. The CD163 guide lentivirus was co-transduced along with the Cas9-expressing lentivirus, lenti-Cas9-Blast (Addgene #52962) at 1:1 v/v. The empty dual guide lentivirus was used as a negative control. CRISPR/Cas9-mediated deletion of CD163 exon7 was determined by genomic DNA PCR amplification using primers (CD163scrnF – ACCTTGATGATTGTACTCTT, CD163scrnR – TGTCCCAGTGAGAGTTGCAG) under the following cycle conditions 98 °C for 1 min then 32 cycles of 98 °C for 10 s, 67 °C for 30 s and 72 °C for 1 min followed by a final extension of 72 °C for 10 min. A wild-type fragment of 941 bp and an edited fragment of 454 bp were expected.

RNASeq analysis

Total RNA was prepared for four technical replicates of porcine PSC and PSCdM samples (K3 cell line) using Qiagen RNeasy kit (#74104) following the manufacturer’s protocol including the recommended on-column DNase treatment. Short-read RNA-Seq libraries were prepared using TruSeq stranded mRNA Library Prep kit (Illumina). In short, poly-A containing mRNA molecules were purified and fragmented. The cleaved fragments were copied into cDNA using reverse transcriptase and random primers. The library was sequenced on an Illumina Novaseq platform to generate 2 × 100 bp paired-end reads.

Bioinformatics

RNA-seq datasets were generated in this study (BioProjcet: PRJNA787759), and other pig tissue and cell-line specific datasets were obtained from NCBI (BioProject: PRJEB19386 and GEO: GSE172284 [56]. Illumina short-read RNA-Seq data was adapter trimmed [57] and aligned to the pig reference genome (Sscrofa11.1 [58]) using STAR (v 2.7.1a) [59] only allowing a maximum of 20 multimappers per read. Mapping rates were consistently above 90%. The number of mapped reads were counted at gene level using featureCount (v. 1.6.3) [60] with the Ensembl pig genome annotation (v.101) [61]. Heat map, sample specific clustering and PCA plots were created in R (https://www.R-project.org/.) using the DESeq2 package [60]. Genes of low or now expression were filtered out (total read counts per gene < 20), and a variance stabilising transformation was used before comparing the samples.

Pig RT-qPCR primer list

Gene Sequence
Ccl22_For TCTGCTGCCGGGACTACATC
Ccl22_Rev CTTCTTCACCCAGGGCAGTC
CD163_For GTGGTCAACTTCGCCTGGTC
CD163_Rev TCAGGTCCCAGCTGTCATCA
Csf1r_For CCACACACACGGAGAGGAAA
Csf1r_Rev TGCGATTCTTCCAGACGAGC
DDX58_For ATCCAAACCAGAGGCAGAGG
DDX58_Rev TCTTTGTCGATCAGATCAGCG
IFN-β_For GTTGCCTGGGACTCCTCAAT
IFN-β_Rev ATGCCGAAGATCTGCTGGAG
IRF3_For TTTTCCCGGCTCACTGTACC
IRF3_Rev CACACCCCACTTCTCGTCAG
IRF7_For GACTTCGGCACCTTCTTCCA
IRF7_Rev CCCGAAGCCCAGGTAGATG
Kdr1_For AGAAGCCAGGCGATGGAAGT
Kdr1_Rev CTTGGCTCAGGACCCACATC
Nanog_For GGTACCCAGCAGCAAATCAT
Nanog_Rev TTACGGTGCAGCAGAAATTG
PU.1_For TACAGGCGTGCAAAATGGAA
PU.1_Rev AAGTCCCAGTAATGGTCGCT
RPL4_For AGGAGGCTGTTCTGCTTCTG
RPL4_Rev TCCAGGGATGTTTCTGAAGG
Runx1_For CCTCTCCTTCTGTCCACCCA
Runx1_Rev GTCAGGTCAGGTGCACTTGA

Bovine RT-qPCR primer list

Gene Sequence
Csf1r_For AGATCTGCTCCCTCCTCCAG
Csf1r_Rev GTTGTTGGGTTGCAGCAGG
Nanog_For ACTTGCTAAGAGTCCCAGTCC
Nanog_Rev TGTACTTCAACAAACCAGCCA
Oct4_For GCAGAGGAAGGGGAGAGCTA
Oct4_Rev TGAACTTCACCTTCCCTCCA
PU.1_For CACTTCACGGAGCTGCAGA
PU.1_Rev CCTCCTCTTCATCCGAGCTG
RPL4_For AATGTCACTTTGCCTGCTGT
RPL4_Rev CTGGGAATTCGAGCCACAG
Runx1_For GCCTCCTTGAACCACTCCAC
Runx1_Rev GGACTGATCATAGGACCACGG

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Disclaimer:

This article is autogenerated using RSS feeds and has not been created or edited by OA JF.

Click here for Source link (https://www.biomedcentral.com/)

By admin