Animal models

C57BL/6 wild-type (WT) mice (8–10 weeks old) were purchased from Pengyue Laboratory Animal Technology Co., Ltd. (Jinan, China). B7-H4-deficient (B7-H4−/−) C57BL/6 mice were purchased from Bioray Laboratories Inc. (Nanjing, China). All mice were kept under specific-pathogen-free (SPF) conditions at 22–26 °C, 50–60% relative humidity, and a 12 h light/dark cycle with sufficient aseptic water and food. Following overnight cohabitation of males with females, the visualization of a plug was designated as gestational day (Gd) 0 of pregnancy.

The genotype of B7-H4−/− mice

Genomic DNA was extracted from the tails of mice using a tissue DNA extraction kit (GeneRay, China). Polymerase chain reaction (PCR) was used to synthesize complementary DNA (cDNA). After initial denaturation (3 min at 95 °C), PCR was performed with 40 amplification cycles of denaturation for 30 s at 95 °C, annealing for 30 s at 55 °C, and extension for 60 s at 72 °C, followed by a final extension for 5 min at 72 °C. PCR products were separated by electrophoresis in 2% agarose gels, and sizes were estimated using Trans DNA Marker I (100–700 base pairs (bp); TransGen Biotech, China). Gels were stained with GelStain (10,000×; TransGen Biotech, China) to visualize DNA. Primers for PCR amplification were as follows: forward: GGCAAAGACGACCTCTCACA; reverse: CCCTTTGCCTTTTGAGGTGC. The expected PCR product sizes were 160 bp (heterozygote), 400 and 160 bp (mutant), and 400 bp (wild-type). Homozygous B7-H4−/− mice were continually bred for the duration of the study.

Preparation of T. gondii RH tachyzoites

Toxoplasma gondii tachyzoites were maintained in HEp-2 cells in minimum essential medium (MEM) (HyClone Laboratories, Logan, UT, USA), 5% fetal bovine serum (FBS; Gibco, Waltham, MA, USA), and 100 IU/ml penicillin/streptomycin (Sigma-Aldrich, St. Louis, MO, USA). After culture, HEp-2 cells were centrifuged at 1500 rpm (433×g) for 10 min, and then the supernatant was centrifuged at 4000 rpm (3082×g) for 7 min to purify tachyzoites. Purified tachyzoites were counted using a Neubauer chamber, resuspended, and cultured in MEM. Experiments were performed in biosafety level 2 (BSL-2) laboratories. All consumable labware and liquids contaminated with tachyzoites were sterilized and autoclaved immediately.

Infection and pregnancy outcomes

WT pregnant female mice were randomly divided into two groups. One group (infected group) was inoculated intraperitoneally (i.p.) with 400 tachyzoites in 200 μl sterile phosphate-buffered saline (PBS) on Gd 8. The other group (uninfected group) was inoculated with 200 μl PBS as a control. In addition, B7-H4−/− pregnant female mice were inoculated i.p. with the same number of tachyzoites as the WT infected group. Mice were euthanized 6 days after T. gondii infection (Gd14) and pregnancy outcomes were observed. Uteri of pregnant female mice were removed, and fetuses were extracted. The numbers of both normal and abnormal fetuses were counted. Abnormal fetuses were characterized by small size, necrotic and hemorrhagic appearance, or complete resorption compared with normal fetuses. The adverse pregnancy rate was calculated as the ratio of abnormal fetus numbers to total fetus numbers. Weights of placentae and fetuses were determined by electronic balance and averaged.

Pathology assessments

Placentae and uteri from each of the three groups were collected after euthanasia on Gd 14; uteri were washed three times in PBS and immediately fixed with 4% paraformaldehyde. After fixation, tissues were washed in tap water and dehydrated in a graded ethanol series of 30%, 50%, and 70%, followed by paraffin embedding with standard methods. Sections were made and stained with hematoxylin and eosin (H&E; Shanghai Novland Co., Ltd., China) according to the manufacturer’s instructions. The images were obtained at 20× magnification.

Scanning electron microscopy (SEM)

On Gd 14, pregnant female mice from all three groups were euthanized, and uteri were harvested. The fetuses were removed, washed five times in 0.1 M phosphate buffer, and fixed in 2.5% phosphate glutaraldehyde buffer at 4 °C for two days. Then, the fetuses were dehydrated with a gradient ethanol series every 15 min. Samples were dried by the critical point technique (Quorum K850), attached to the specimen scaffold, and coated with gold particles by ion sputter coating (Quorum Q150RS). All specimens were observed using a scanning electron microscope (Zeiss EVO LS15) operated at 10 kV, and images were obtained by SmartSEM user interface software.

Cell preparation of mice

Uteri and placentae were carefully separated from pregnant female mice after euthanasia on Gd 14 and were washed twice in ice-cold PBS. Tissues were then cut into 1–3 mm pieces, and single-cell suspensions were obtained by filtration through 48 µm sterile nets. Mononuclear cells were obtained using Ficoll density gradient centrifugation in mouse lymphocyte separation medium (TBD Science, China) and used for flow cytometry analysis.

Collection of human clinical samples

Clinical samples of decidual tissues were collected in the Department of Obstetrics and Gynecology of Yantai Affiliated Hospital of Binzhou Medical University and the Yantai Zhifu District Maternal and Child Health Hospital. Tissues were washed five to eight times with PBS, and the villi were removed from the tissues under sterile conditions. Decidual tissues were delivered to our laboratory within 2 h and were kept in Dulbecco’s modified Eagle medium (DMEM)/high-glucose medium (HyClone, USA) with 100 IU/ml penicillin and 100 μg/ml streptomycin (Sigma-Aldrich, USA).

Purification of human dDCs

Decidual tissue was isolated and cleaned by shaking in ice-cold PBS four times before tissue was cut into 0.1 cm pieces. Single-cell suspensions were isolated by incubating the tissues in the digestion buffer (RPMI, 1 mg/ml Collagenase IV and DNase I) for 60 min, then filtrated through 48 µm sterile nets. Mononuclear cells were isolated by density gradient centrifugation using a human lymphocyte separation medium (TBD Science) at 2000 rpm for 20 min at 20 °C. Purification of dDCs from monocytes was performed using the EasySep Human Myeloid DC Enrichment Kit (STEMCELL Technologies, Canada) according to the manufacturer’s instructions, with > 95% purity ensured for experiments. The marker of purified dDCs was negative selection of lineage (CD3, CD14, CD19, CD20, CD34, CD56). The purified dDCs were used for Western blot analysis.

Human dDC culture and treatment

To test the effects of B7-H4 expression on human dDCs during T. gondii infection, approximately 1.5 × 106 purified human dDCs were divided equally into three groups: uninfected, infected, and B7-H4-neutralized infected groups. In the B7-H4-neutralized infected group, dDCs were preincubated with anti-B7-H4 monoclonal antibody (mAb; 10 μg/ml) (eBioscience, San Diego, CA, USA) for 2 h. Toxoplasma gondii tachyzoites were added to the infected group and the B7-H4-neutralized infected group at a ratio of 2:1 (T. gondii: cells) followed by incubation for 24 h.

To test the role of STAT3 on enzyme and cytokine expression in dDCs during T. gondii infection, purified human dDCs were equally divided into four groups: uninfected, infected, STAT3-inhibitor, and STAT3-inhibitor infected groups. Cells of the STAT3-inhibitor and the STAT3-inhibitor infected groups were preincubated with Stattic (HY-13818, MedChem Express), a STAT3 inhibitor, which inhibited STAT3 phosphorylation. After 2 h, T. gondii tachyzoites were added to the STAT3-inhibitor infected group and the infected group at the same time as described above.

Flow cytometry

Mouse decidual mononuclear cells or human DCs were incubated with corresponding mAbs at 4 °C in the dark for 30 min and then washed once. Cells were first incubated with antibodies against the cell surface proteins B7-H4, CD80, CD86, and MHC-II (mouse) or HLA-DR (human), fixed using a fixation and permeabilization kit (eBioscience, USA) according to the manufacturer’s instructions, and incubated with antibodies of intracellular proteins (IDO, IL-10, or IL-12). To analyze cytokines, cells were cultured for 4–6 h in a leukocyte activation cocktail (eBioscience, USA) before adding mAbs of cytokines. Analysis was performed using a FACSCanto II instrument (Becton Dickinson [BD], Franklin Lakes, NJ, USA) and FlowJo v.10.3 software (FlowJo, LLC, Ashland, OR, USA).

The following mouse-specific mAbs were used for flow cytometry: FITC-conjugated anti-CD11c, APC-conjugated anti-IDO (all from eBioscience, USA), PerCP-Cy5.5-conjugated anti-CD8α, PE-conjugated anti-CD80, PE-conjugated anti-CD86, PE-conjugated anti-MHC-II, PE-conjugated anti-IL-10, and PE-conjugated anti-IL-12 (all from BD, USA), and APC-conjugated anti-B7-H4 (BioLegend, San Diego, CA, USA).

The following human-specific mAbs were used: BV421-conjugated anti-BDCA1, BV421-conjugated anti-BDCA2, and BV421-conjugated anti-BDCA3, PE-Cy7-conjugated anti-CD14, PE-Cy7-conjugated anti-CD19, PE-Cy7-conjugated anti-CD123 (all from BD, USA), APC-conjugated anti-B7-H4 (BioLegend, USA), PE-conjugated anti-CD80, PE-conjugated anti-CD86, and PE-conjugated anti-HLA-DR (all from eBioscience, USA).

Immunofluorescence (IF) imaging

Purified human dDCs from uninfected, infected, or B7-H4-neutralized infected groups were fixed in 4% paraformaldehyde for 30 min and blocked with goat serum for 1 h at 37 °C. dDCs were incubated overnight at 4 °C with a primary antibody. After washing three times with PBS, cells were incubated with secondary antibodies for 1 h at 37 °C, stained with 4′,6-diamidino-2-phenylindole (DAPI) for 15 min, and again washed three times with PBS. Finally, cells were examined using confocal microscopy (Zeiss LSM 880).

Western blot analysis

A total of 1 × 107 cells of each group were lysed with pre-cooled RIPA lysis buffer with the serine protease inhibitor phenylmethylsulfonyl fluoride (PMSF) and protein phosphatase inhibitor. After cooling on ice for 30 min, lysates were centrifuged for 20 min at 12,000×g. The supernatant was harvested and analyzed for protein concentration using a BCA [bicinchoninic acid] protein assay kit (Beyotime). Protein samples were then boiled in 5× loading buffer (Beyotime) for 8 min. Samples containing 30 μg of total protein were resolved by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), and proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore Corporation, Billerica, MA, USA). Each membrane was blocked with 5% nonfat milk in 1× Tris-buffered saline with Tween (TBST) for 2–3 h at room temperature. Each membrane was then incubated with a primary antibody overnight at 4 °C and a secondary antibody for 2 h at room temperature. The membrane was washed six times with 1× TBST for 30 min. Then, membranes were quantified with an enhanced chemiluminescence (ECL) detection kit (Roche, Ltd., Switzerland). Protein levels were analyzed by ImageJ software (Rawak Software, Inc., Germany).

Statistical analysis

All data are presented as means ± standard deviations (SD). The statistical analyses were conducted using the GraphPad Prism 8 statistical software package. Differences in means were determined and analyzed by unpaired t-tests. (*/P < 0.05; **/P < 0.01; ***/P < 0.001 or ****/P < 0.0001), P < 0.05 were considered statistically significant.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Disclaimer:

This article is autogenerated using RSS feeds and has not been created or edited by OA JF.

Click here for Source link (https://www.biomedcentral.com/)