Reagents

β-Ketoadipate was obtained from Finetech Industry Limited (Wuhan, China). Molecular biology experimental reagents were purchased from TaKaRa Biotechnology (Dalian, China) Co. unless otherwise noted. Other chemicals used in the study were purchased from J&K Scientific Ltd., China.

Construction of 4-FP degradation strain BL-fpd

The genes used for 4-FP degradation in this study included fpdA2, fpdB, fpdC (Genbank: AB530681.1), and fpdD (Genbank: AB530680.1) from Arthrobacter sp. strain IF1. The above four gene sequences were optimized and analyzed by online tools (GenSmart™ Codon Optimization, https://www.genscript.com/tools/gensmart-codon-optimization; http://www.detaibio.com/tools/index.php?r=site%2Findex), and then checked and modified manually. These genes were optimized with E. coli preference codon. The specific recognition sites of endonucleases in the gene sequences were eliminated to facilitate vector construction. GC content was balanced. Reverse repeat sequences of genes or adjacent genes within 200 bp and stem-loop structures were removed to improve the mRNA stability. The optimized genes named as fpdA2S (Genbank: OM108470), fpdBS (Genbank: OM108471), fpdCS (Genbank: OM108472), and fpdDS (Genbank: OM108473) were chemical synthesized and verified by DNA sequencing (Sangon Biotech Co., China).

Two gene expression cassettes named T7fpdA2S–T7fpdBS and T7fpdCS–T7fpdDS were constructed by connecting T7 promoter (5’-CTCGAGCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC) at the 5′-end and T7 terminator (5’-CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGTCGACGGTGACGTTGAGCATGGT) at the 3′-end of each gene using an improved overlapping extension PCR method (Peng et al. 2006). The primers for gene expression cassettes construction were shown in Additional file 1: Table S1 and the PCR conditions were shown in Additional file 1: Fig. S1. A modified vector pCAMBIA1301 harboring the lactose operon repressor (lacI) gene (Genbank: MK720606.1) (Wang et al. 2019) was used to construct the expression vector, so that IPTG could be used to enhance the regulation of protein expression. This vector was suitable for the expression of long fragment genes. Two cassettes T7fpdA2S–T7fpdBS and T7fpdCS–T7fpdDS were successively inserted into the EcoRI/SalI sites and SalI/HindIII sites of the modified vector pCAMBIA1301 by twice ligations and transformations. The correct construction of the expression vector was identified by restriction enzyme digestion and sequencing. The obtained multi-monocistronic expression vector named pC1301-fpdA2BCDS was then transformed into E. coli BL21-AI (Invitrogen, USA) to construct the strain BL-fpd (Fig. 1a). E. coli BL21-AI carrying the modified pCAMBIA1301was named as BL-control.

Culture conditions

E. coli BL-fpd was inoculated into 50 mL of LB medium (10 g tryptone, 5 g yeast extract, and 10 g NaCl per liter) containing 50 mg/L kanamycin and cultured at 37 ℃ until OD600 reached 0.6. Then the cells were collected washed with double distilled water and resuspended with the same volume of M9 medium (10 g glycerol, 6 g Na2HPO4, 3 g KH2PO4, 1 g NH4Cl, 0.5 g NaCl, 0.5 mmol MgSO4, 0.1 mmol CaCl2, and 5 g acid-hydrolyzed casein per liter) containing 50 mg/L kanamycin. The inducer containing L-arabinose and isopropyl-β-D-thiogalactoside (IPTG) was added (or not added) to the culture, and the bacteria were induced at different temperatures. BL-control was used as control.

Gene expression analysis

BL-control and BL-fpd were cultured with LB medium until OD600 reached 0.6 at 37 ℃, and their plasmids were extracted. The specific fragments of the four genes were amplified by PCR using the extracted plasmids as templates and identified by DNA sequencing. Total RNA from E. coli BL-fpd and BL-control were extracted after 3 h of induction using the RNA extraction kit (TRIzol) according to the manufacturer’s manual. The cDNA was synthesized at 42 ℃ for 15 min by TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix. The Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on the Bio-Rad MJ Mini personal thermal cycler using SYBR Premix Ex Taq II (Takara Bio Inc.). The E. coli 16S rRNA gene (Genbank: NR_024570.1) was used as an internal control. The specific primers used for PCR/qRT-PCR and PCR/qRT-PCR conditions were shown in Additional file 1: Table S2. The relative expression values of the genes were calculated by 2–ΔCT = 2−[CT(target)−CT(16S)] (Wang et al. 2019).

Study on protein expression and biodegradation conditions

The effect of induction temperature on the degradation capacity of 4-FP of the strain BL-fpd was investigated by adding 2 mM 4-FP and 10 μM FAD+ to the culture after 3 h of induction at different temperatures (25 ℃, 30 ℃ and 37 ℃). The effect of inducer concentration (low dose inducer 1: 0.2 g/L final concentration of L-arabinose and 0.1 mM final concentration of IPTG; high dose inducer 2: 2 g/L final concentration of L-arabinose and 1 mM final concentration of IPTG) on 4-FP degradation was also investigated. The degradation of 4-FP over time and intermediate metabolites (hydroquinone, hydroxyquinol), the product inorganic fluoride and β-ketoadipate were detected. The concentration of inorganic fluorine in the supernatants was measured by an ion meter (PXSJ-227L, INESA Scientific Instrument Co., Ltd., China) equipped with a fluoride electrode (PF-202-L, INESA). Sodium fluoride standard was prepared for the calibration curve. Analysis for the concentrations of 4-FP, hydroquinone and hydroxyquinol were determined by high performance liquid chromatography (HPLC) as described below, and the concentrations of β-ketoadipate were detected by gas chromatography-mass spectrometry (GC–MS).

Assay of 4-FP tolerance

E. coli BL-fpd was induced for 3 h with inducer 2 in M9 medium at 37 ℃, followed by adding 4-FP of different concentrations (0, 2, 4, 6, 8 mM) and 10 μM FAD+. Cell growth was measured by the optical density of the culture at 600 nm.

The cell morphology of the strains was examined by scanning electron microscope (SEM) (TM4000 plus, Hitachi). BL-control and BL-fpd were induced for 3 h and then treated with 4 mM 4-FP for 12 h. The cells were collected and pre-treated according to the method in reference (Rocha et al. 2011).

Degradation substrate spectrum of BL-fpd

To study the degradation substrate spectrum of strain BL-fpd, a series of organic compounds (4-FP, 4-chlorophenol, 4-bromophenol, 4-nitrophenol, and hydroquinone) were tested as substrates. BL-fpd was induced for 3 h with inducer 2 at 37 ℃, followed by adding 2 mM of various substrates and 10 μM FAD+. The degradation of each substrate was analyzed by HPLC after 3 h. The strain BL-control was used as a control.

Biodegradation of 4-FP in wastewater

To test the biodegradation ability of BL-fpd to 4-FP in wastewater, the wastewater mainly containing 4-FP from a chemical plant in Changzhou, China, was used for the degradation by engineered bacteria. The content of 4-FP in the wastewater was 0.12 mM and the pH value was 6.5. The reaction mixture consisted of 4 mL wastewater containing 4-FP (the concentration of 4-FP was artificially increased to 1 mM), 10 μM FAD+ and 1 mL bacterial culture after 8 h induction by inducer 2. The content of residual 4-FP was determined by HPLC after 3 h reaction at 37 °C.

HPLC and GC–MS analysis

Compounds were analyzed by HPLC equipped with an ultraviolet spectrophotometric detector (Agilent 1100 VWD) and an Athena C18 reversed-phase column (250 mm × 4.6 mm × 5 μm, ANPEL Inc., China) at 30 ℃. To detect 4-FP, 20 μL samples were eluted at a flow rate of 1 mL/min with a solution of water/acetonitrile (70:30) and monitored at 223 nm. Hydroquinone and hydroxyquinol were analyzed at 280 nm using a 5 − 30% linear gradient of acetonitrile for 20 min, and the flow rate was 0.5 mL/min. Calibration curves were plotted by peak area versus concentration of each standard. The detection conditions of 4-chlorophenol and 4-bromophenol were as follows: The mobile phase was water/methanol (30:70) at a flow rate of 0.8 mL/min, and the detection wavelength was 280 nm. 4-nitrophenol was detected at 280 nm using a mobile phase of water/methanol (45:55) at a flow rate of 0.5 mL/min.

β-Ketoadipate in the culture was treated and detected by GC–MS regarding the method used by Okamura-Abe et al. (2016). Briefly, 500 μL culture was acidified to below pH 2 with concentrated hydrochloric acid and extracted twice with 500 μL ethyl acetate (benzoic acid as internal standard). Then 200 μL of the organic phase was evaporated for further steps. The samples were derivatized by trifluoroacetamide and determined by GC–MS/MS 7890B-7000C system (Agilent) equipped with an HP-5 MS column (30 m × 0.25 mm × 0.25 μm, Agilent). The column oven temperature increased from 100 ℃ to 160 ℃ with a rate of 40 ℃/min, then 10 ℃/min from 160 ℃ to 250 ℃ and 20 ℃/min from 250 ℃ to 300 ℃. For β-ketoadipate identification, the derived sample mass spectra were compared with the corresponding standard spectra. The standard curve of peak area versus concentration was used to determine the concentration of β-ketoadipate.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Disclaimer:

This article is autogenerated using RSS feeds and has not been created or edited by OA JF.

Click here for Source link (https://www.springeropen.com/)