Cell culture

Rat microglia (RM) were purchased from ScienCell (R1900, USA). Microglia were grown in high glucose medium with 10% fetal bovine serum and cultured in a 37℃ cell incubator with 5% CO2. When microglia were 65%-70% confluent, the microglia were stimulated with LPS (10 μg/ml). Total RNA and protein were extracted 48 h post-treatment.

RNA immunoprecipitation (RIP) and RNA sequencing

RIP was carried out using an Immunoprecipitation kit (Millipore, USA) as described in the product instructions. The cell lysate was initiated with anti-P65 antibody (Abcam, USA) or isotype control IgG (Abcam,USA). The RNA-protein complexes were precipitated with protein A magnetic beads. The U1 small nuclear RNA (snRNA) served as the negative control snRNA of Tug1. The immunoprecipitated RNA was isolated using Trizol (Takara, Japan) and further RT-PCR analysis was performed. The purified RNA was sequenced.

Rat model of SE

Male SD rats aged 14 days were raised in the Experimental Animal Center of Shanghai Public Health Clinical Center. 24 h post-injection of pilocarpine (20 mg/kg, i.p.), the rats were given 127.3 mg/kg lithium chloride (i.p.). And 1 mg/kg scopolamine was injected intraperitoneally 30 min before pilocarpine. Status epilepticus (SE) was scored on the Racine scale. After 60 min of SE, the convulsion was terminated with 10 mg/kg diazepam.

Cell transfection

To overexpress Tug1, full-length Tug1 was cloned into the adenovirus vector (HBAD-r-Tug1-Null-EGFP). Then the RM were transfected with HBAD-r-Tug1-Null-EGFP (OE-Tug1) adenovirus or negative control (OE-NC) empty HBAD-EGEP adenovirus using LipofectamineTM 2000 (ThermoFisher, USA). Small interfering RNA of lncRNA Tug1 (si-Tug1) was designed by GenePharma company (Shanghai, China) to knock down Tug1. The negative control siRNA (si-NC) was used as negative control. The above primer sequences are given below: si-Tug1: sense 5’-GGUCUUCUACCCCU-3’; antisense 5’ UACCGAUGCAGAAUAGAAGC; si-NC: sense 5’-GGUCCCGAACGUGUCACG-3’; antisense 5’-AUGCGCCAUGCU-3′. The siRNAs were transfected using LipofectamineTM 2000 (ThermoFisher, USA) according to the instruction manual.

Western blotting

Proteins of rat hippocampal tissues and microglia were extracted by using 1% PMSF. The SDS-PAGE proteins (15-20 μg) were separated and transferred to membrane. The PVDF membrane were blocked with blocking solution for 30 min. And incubated with the primary antibody for p-p65, p65, p-IκBα, IκBα, IL-1β or TNF-α overnight rotation at 4 degrees. HRP-conjugated secondary antibody were incubated at room temperature. Blot bands were developed with ECL kit and quantified using the ImageJ software (USA). GAPDH served as the normalization control for quantification of the proteins.

RT-PCR

Rat hippocampal and cells were treated with Trizol (Takara, Japan). Tissue was homogenized by a tissue homogenizer. Chloroform and isoamyl alcohol were used to extract mRNA. RNA concentration was quantified using spectrophotometer and the Prime Script reagent kit (Takara, Japan) was used for reverse transcription. PCR reactions was carried out using the PCR kits (Takara, Japan). The mRNA expression level was normalized to GAPDH. The primers sequences are given below: Tug1 (5ʹ-CCGGATTAACACCAAGGAAG-3ʹ) and (5ʹ-TTAGCGGGCCATATA-3ʹ), GAPDH (5ʹ-TTCGCCATGGATATC-3ʹ and 5ʹ-TAGGAGTCCTTCTATAC-3ʹ), and IL-β (5ʹ-CACACTAGCAGG TCATCC-3ʹ and 5ʹ-ATCTCAC AGCAGCATCTCGACAAG-3ʹ).

Immunofluorescence staining

Paraformaldehyde (4%) was used to fix the microglia. Cells were permeabilization with 0.1% Triton (ThermoFisher, USA) for 15 min and followed by blocking with 1% BSA at room temperature for at least 1 h. Primary antibody incubations were performed in microglia overnight at 4-degrees. Secondary antibodies and DAPI were incubated after TBST wash. Stained cells were observed using fluorescence microscopy.

Statistical analysis

All data analyses were analyzed using GraphPad Prism 7.0 statistical software. Comparisons between groups were carried out using one-way ANOVA or t-test. Pearson’s correlation analysis to determine p and r values. P value of less than 0.05 was considered statistically significant. Unless otherwise stated, all experiments were repeated three times with three replications each.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Disclaimer:

This article is autogenerated using RSS feeds and has not been created or edited by OA JF.

Click here for Source link (https://www.biomedcentral.com/)