Cell culture

The cells (viz. 183-E95 cell line, NCBI-Iran, Catalog no. C492) were cultured onto the Roswell Park Memorial Institute (RPMI) 1640 medium, added by 15% v/v fetal calf serum (FCS). In addition, streptomycin (100 μg/ml) and penicillin (100 U/ml) (Gibco, Paisley, UK) in a wet medium with 5% carbon dioxide (CO2) were maintained at the temperature of 37 °C in specific flasks with 25 cm2 area. The cells were then kept at their exponential growth phase because of weekly twice passages.

Cell transfection

The miR-221 sequence (GAAACCCAGCAGACAAUGUAGCU) was extracted from http://www.mirbase.org. The miRNA inhibitor as a negative control (scrambled) and the miRCURY™ LNA miRNA inhibitor for hsa-miR-221 were further acquired from Exiqon (Denmark). In addition, the transfected cells were identified by the oligonucleotides labeled 5′ with the 6-carboxyfluorescein (6-FAM) dyes. The Lipofectamine RNAiMAX™ transfection reagent (Invitrogen, Germany, Cat. no. 13778030) was further applied for the 183-E95 cell transfection based on the related protocol. Thus, a density of 5 × 105 cells was added to a 6-well petri dish (Nunc, Roskilde, Denmark) in the exponential growth phase in the presence of the RPMI 1640 (1.8 mL of per well) with no antibiotics and FCS. After adding the miRCURY™ LNA miRNA inhibitor (30 pmol) to the Lipofectamine RNAiMAX™ transfection reagent (5 μL) in the Opti-MEM Medium™ (200 μL) (Gibco, Paisley, UK), the incubation was performed at an ambient temperature for 15 min, which was then appended by the cells to cover the whole plate surface, and incubated for 8 h. Afterward, the antibiotics and FCS were added, and the incubation was completed at different intervals of 24, 48, and 72 h. Simultaneously with the LNA-anti-miR transfected cells, the culture continued for the untreated and scrambled-LNA transfected ones. Fluorescence microscopy (FM) and flow cytometry (FC) were consequently applied to evaluate the transfection efficiency. The LNA-conjugated 6-FAM was also employed to determine and count the LNA-transfected cells via a flow cytometer and a fluorescent microscope (Partec, Germany).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Firstly, the RT-qPCR technique was recruited to evaluate the miR-221 expression level in the B-CLL cell line (183-E95) and analyze the miR-221 inhibition efficiency via the LNA anti-miR, and then the p27 gene expression at different intervals of 24, 48, and 72 h following inhibition. Thus, the extraction of the total cell RNA was performed after 24, 48, and 72 h of transfection using miRCURY RNA Isolation Kit™ (GeneAll, Seoul, Korea), followed by the complementary DNA (cDNA) construction via the Universal cDNA Synthesis Kit™ (Parsgengan, Tehran, Iran). Consequently, the PCR process was accomplished by exploiting the SYBR Green Master Mix Kit (Takara, Japan), the miR-221 primers, and the p27 gene, whose materials were from Metabion, Germany, and the Synthetic RNA Snord 47 templates and primers were considered as internal controls.

Cell viability assessment

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay was applied to measure cell viability, so that a reduction in MTT was the result of the intact cell conversion into the purple formazan products via mitochondrial dehydrogenase. This reaction was related to the count of the viable cells. After transfection, the MTT assay was carried out at different intervals of 24, 48, and 72 h. Thus, the MTT (Sigma-Aldrich, USA) at a concentration of 50 mg/mL (200 µl) was poured on 5 × 105 floating 183-E95 cells in the RPMI 1640 medium (2 ml), followed by incubation at 37 °C for 4 h in a dark condition. In addition, each well was appended by 200 µl of dimethyl sulfoxide (DMSO) (Sigma-Aldrich, USA) and stirred to dissolve the crystals. The blank samples were further prepared according to the same protocol; however, they had no cells. To determine the absorbance, a spectrophotometer at 570 nm wavelength was utilized.

Apoptosis assay

The apoptosis induction in the 183-E95 cells was evaluated using the Annexin V Staining Kit™ (Roche, Germany). Thus, the phosphatidylserine was detected by this kit in the apoptotic cells, and propidium iodide (PI) staining was performed for the necrotic cell discrimination. Based on the relevant protocol recommended for this purpose, staining was conducted after 24, 48, and 72 h of transfection. At this step, the control was considered as the untreated cells, and the analysis of the cells was performed via a flow cytometer with 500-nm excitation, 520-nm bandpass filter for the detection of fluorescein-conjugated Annexin V, and a 600-nm filter for the PI determination.

In silico evaluation of miRNA binding sites

The in silico analysis of the miRNA binding sites was compared in the genes via the online prediction tools of miRWalk, RegRNA 1.0, miRanda, and TargetScan4.2 (http://www.targetscan.org). The data showed the uniqueness of the miRNA binding sites and rolled out the off-targets.

Statistical analysis

The statistical analyses were conducted using the SPSS (Ver. 16) software package, exploiting independent-samples t-test and one-way analysis of variance (ANOVA) to investigate the inter-group differences. The significance level was further statistically estimated at p-value < 0.05. All the experiments were tested in triplicate.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Disclaimer:

This article is autogenerated using RSS feeds and has not been created or edited by OA JF.

Click here for Source link (https://www.springeropen.com/)